View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_high_47 (Length: 228)
Name: NF8208A_high_47
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_high_47 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 30 - 228
Target Start/End: Complemental strand, 39495616 - 39495416
Alignment:
| Q |
30 |
atcagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaacttcatggtttagtgcttatgatt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495616 |
atcagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaacttcatggtttagtgcttatgatt |
39495517 |
T |
 |
| Q |
130 |
tgtgaatacaggcattgtgtagagtatatt--ggtaagctattatgcagtgttaatagtattagtaactgataattacataagttgttatgttagtcatc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495516 |
tgtgaatacaggcattgtgtagagtatattggggtaagctattatgcagtgtgaatagtattagtaactgataattacataagttgttatgttagtcatc |
39495417 |
T |
 |
| Q |
228 |
g |
228 |
Q |
| |
|
| |
|
|
| T |
39495416 |
g |
39495416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University