View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_100 (Length: 334)
Name: NF8208A_low_100
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_100 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 148 - 314
Target Start/End: Complemental strand, 30877981 - 30877815
Alignment:
| Q |
148 |
catcactatcacactccaaaacaactctgacacagaacaaacacctctccttattccattgtttccaaggttgtctcctgtgtttggtccccacaaacaa |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877981 |
catcactatcacactccaaaacaactctgacacagaacaaacacctctccttattccattgtttccaaggttgtctcctgtgtttggtccccacaaacaa |
30877882 |
T |
 |
| Q |
248 |
ctctcctttttcatttctcttttcactttgctatggaaatggaaggttatgatattcttggagatgc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30877881 |
ctctcctttttcatttctcttttcactttgctatggaaatggaaggttatgatatatttggagatgc |
30877815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University