View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_112 (Length: 328)
Name: NF8208A_low_112
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_112 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 7e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 5 - 108
Target Start/End: Complemental strand, 29102123 - 29102022
Alignment:
| Q |
5 |
cattatgtaccaagaacaggcaaaatcggtttaagaaagctactagtacttgataataactctgtttttgaatagagatattatttatgtaccaccatgt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
29102123 |
cattatgtaccaagaacaggcaaaatcggtttaagaaagctactagtacttgataataactctgtttttgaat--agatattatttctgtaccaccatgt |
29102026 |
T |
|
| Q |
105 |
tttt |
108 |
Q |
| |
|
|||| |
|
|
| T |
29102025 |
tttt |
29102022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University