View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_118 (Length: 316)
Name: NF8208A_low_118
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_118 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 4 - 310
Target Start/End: Complemental strand, 5395566 - 5395260
Alignment:
| Q |
4 |
atgtagaagtacaacgaacctcacttagagaatttctccaactcgacaccactctccgccaaaatgcacaacttaaagaagctatgaattcaacctactc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395566 |
atgtagaagtacaacgaacctcacttagagaatttctccaactcgacaccactctccgccaaaatgcacaacttaaagaagctatgaattcaacctactc |
5395467 |
T |
 |
| Q |
104 |
acgtattcaaagccttgagaaagagcttagttgcatgaagaagtttcttcaggatcatcaagctgaggatgaaaaggagaaggagaaaggaaaagagaag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5395466 |
gcgtattcaaagccttgagaaagagcttagttgcatgaagaagtttcttcaggatcatcaagctgaggatgaaaaggagaaggagaaagaaaaagagaag |
5395367 |
T |
 |
| Q |
204 |
gaacaaagcaatagtgtcttgaattcagaacgttccgcaagttttcattttgttccggttgatgaaaacagtaaaatacaaagaggtggaagaggctcta |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395366 |
gaacaaagcaatagtgtcttgaattcagaacgttccgcgagttttcattttgttccagttgatgaaaacagtaaaatacaaagaggtggaagaggctcta |
5395267 |
T |
 |
| Q |
304 |
tttcttc |
310 |
Q |
| |
|
||||||| |
|
|
| T |
5395266 |
tttcttc |
5395260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University