View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_148 (Length: 296)
Name: NF8208A_low_148
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_148 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 328021 - 328310
Alignment:
| Q |
1 |
aatatatctcgtgaagcacaaacaatggtactagtggaccaccctaacgtgctaaaatcacactgttcattcgtgagtgatcacaatctatgggttgtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
328021 |
aatatatctcgtgaagcacaaacaatggtactagtggaccaccctaacgtgctaaaatcacactgctcattcgtgagtgatcacaatctatgggttgtga |
328120 |
T |
 |
| Q |
101 |
tgccattcatgtcgggtggttcatgtcttcacatattgaaagctgcacatcctgatgggtttgaagaggttgttattgcaactgtgctcagggaggtatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
328121 |
tgccattcatgtcgggtggttcatgtcttcacatattgaaagctgcacatcctgatggatttgaagaggttgttattgcaactgtgctcagggaggtatt |
328220 |
T |
 |
| Q |
201 |
gaagggtttagagtatcttcatcatcatggtcacattcaccgtgacgttaaggcgggtaatgttctcatcgattctcgcggtgcggttaa |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
328221 |
gaagggtttagagtatcttcatcatcatggtcacattcaccgtgacgttaaggcgggtaatgttctcattgattctcgcggtgcggttaa |
328310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University