View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_175 (Length: 278)
Name: NF8208A_low_175
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_175 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 21 - 278
Target Start/End: Original strand, 29357519 - 29357773
Alignment:
| Q |
21 |
agaaacaaacatgcaaatcccagaccatggacaaatccacagtcacttatttttagtcttaattcatatcaaaacacaatgacaataacaaccaaataca |
120 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29357519 |
agaaacaaacatgcaaatccc-gaccatggacaaatccacagtcacttatttt-agtcttaattcatatcaaaacacaatgaca-taacaaccaaataca |
29357615 |
T |
 |
| Q |
121 |
aagcgatggtaacaagtaacaaccacatgacgcttcaacggaaaaatggatttggccaaaacccatttgggggattgacatttcccataggaggtgcctg |
220 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29357616 |
aagcgatggtaaaaagtaacaaccacatgacgcttcaacggaaaaatggatttggccaaaacccatttgggggattgacatttcccatgggaggtgcctg |
29357715 |
T |
 |
| Q |
221 |
atccccaccaccattattcatcaagttcatnnnnnnntgttgcttctgcataacatcc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29357716 |
atccccaccaccattattcatcaagttcataaaaaaatgttgcttctgcataacatcc |
29357773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University