View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_184 (Length: 273)
Name: NF8208A_low_184
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_184 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 39495593 - 39495822
Alignment:
| Q |
1 |
ttaatctattttctactctctgatgatatcagtcatatgcatgcttgaattaggtacatttatttatcataaactgaaatctctggattttggaacacta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495593 |
ttaatctattttctactctctgatgatatcagtcatatgcatgcttgaattaggtacatttatttatcataaactgaaatctctggattttggaacactg |
39495692 |
T |
|
| Q |
101 |
ttgcaatctgcaggtccccatccaatcaactgcttctcattgtcgaataccatcactttgtctagcatggatatgtctgcgtaaaaaataataccaacac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39495693 |
ttgcaatctgcaggtccccatccaatcaactgcttctcgttgtcgaataccatcactttgtctagcatggatatgtctgcataaaaaataataccaacac |
39495792 |
T |
|
| Q |
201 |
ttacataacataatgcagagttcatgaatc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39495793 |
ttacataacataatgcagagttcatgaatc |
39495822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 74 - 180
Target Start/End: Original strand, 44373163 - 44373269
Alignment:
| Q |
74 |
ctgaaatctctggattttggaacactattgcaatctgcaggtccccatccaatcaactgcttctcattgtcgaataccatcactttgtctagcatggata |
173 |
Q |
| |
|
|||| |||| ||||||||||||| | || |||||||| | | ||| || |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44373163 |
ctgacatctttggattttggaactcggttacaatctgctgctgtccaacctatcaactgcttctcattgtcaaataccatcactttgtctagcatggata |
44373262 |
T |
|
| Q |
174 |
tgtctgc |
180 |
Q |
| |
|
||||||| |
|
|
| T |
44373263 |
tgtctgc |
44373269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University