View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_187 (Length: 272)
Name: NF8208A_low_187
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_187 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 16 - 106
Target Start/End: Complemental strand, 22665574 - 22665484
Alignment:
| Q |
16 |
tgaagatgatggcactttttaatgatgacaatgcaaacgcatgttcaatcatgtaatttcatttagggaaatgttttgtgtagggtgtata |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22665574 |
tgaagatgatggcactttttaatgatgacaatgcaaacgcatgttcaatcatgtaatttcatttagggaaatgttttgtgtagggtgtata |
22665484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 193 - 266
Target Start/End: Complemental strand, 22665400 - 22665327
Alignment:
| Q |
193 |
gtgttgaattgatttgtaaaatttatagcgtttgttctctttgtcagtttcaaccatcaattctttggataaat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22665400 |
gtgttgaattgatttgtaaaatttatagcgtttgttttctttgtcagtttcaaccatcaattctttggataaat |
22665327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University