View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_207 (Length: 263)
Name: NF8208A_low_207
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_207 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 7 - 262
Target Start/End: Complemental strand, 43703204 - 43702949
Alignment:
| Q |
7 |
gataaaagtaatgtgaataaaaccaagtttaaactttgtagtgaaataaagtatgttttattttgctcaaaaagcaagtctaacatgaaactttggtgta |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703204 |
gataaaagtaatgtgaataaaacaaagtttaaactttgtagtgaaataaagtatgttttattttgctcaaaaagcaagtctaacatgaaactttggtgta |
43703105 |
T |
 |
| Q |
107 |
aatttctctgcataagtgtaactgttgatgttcattatttgagtctcactgttaatgttcattgttctctatagaattaaaaagtgagcacaagagtgct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703104 |
aatttctctgcataagtgtaactgttgatgttcattatttgagtctcactgttaatgttcattgttctctatagaattaaaaagtgagcacaagagtgct |
43703005 |
T |
 |
| Q |
207 |
aagtggaacttacagaactgatgtaatcgagaagagcagcatattcttcgacatcc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| |
|
|
| T |
43703004 |
aagtggaacttacagaactgatgtaatcgagaagagcagcatttgcttcgccatcc |
43702949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University