View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_23 (Length: 427)
Name: NF8208A_low_23
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 17 - 331
Target Start/End: Original strand, 37121514 - 37121830
Alignment:
| Q |
17 |
catcatccacaacccacaatgaactttgtagataaattagcagatatattaccgagtactattactaaagctaatttaaaatgacaccgtctagttctca |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37121514 |
catcatccacaacccacaatgaactttatagataaagtagcagatatattaccaagtactattactaaagctaatttaaaatgacaccgtctagttctca |
37121613 |
T |
|
| Q |
117 |
ccatgttatgtttcgtccatcccatcttctatggactatgatgattgatggtgtcaggaatttcccatagggggatttgtaggcgat--ccccccatacc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37121614 |
ccatgttatgtttcgtccatcccatcttctatggactatgatgattgatggtgtcaggaatttcccatagggggatttgtaggcgatccccccccatacc |
37121713 |
T |
|
| Q |
215 |
taaaaattctgagatgtgcacttgtctttagaaaagttcataatgaaaatggaatccatctacggggggatttgtaggggatcccacttgtcttcagcag |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37121714 |
taaaaattctgagatgtgcacttgtctttagaaaagttcataatgaaaatggaatccatctatagggggatttgtaggggatcccacttgtcttcagcag |
37121813 |
T |
|
| Q |
315 |
aatccatactgaaatct |
331 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37121814 |
aatccatactgaaatct |
37121830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 324 - 407
Target Start/End: Original strand, 37121900 - 37121983
Alignment:
| Q |
324 |
tgaaatcttttcattcaattaactttttaaaagaccctttattgttgatatttcaatcttactaatgcttttccctgtacttgt |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37121900 |
tgaaatcttttcattcaattaactttttaaaagaccctttattgttgatatttcaatcttactaatgcttttccctgtatttgt |
37121983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University