View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_234 (Length: 251)
Name: NF8208A_low_234
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_234 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 11 - 240
Target Start/End: Complemental strand, 15402157 - 15401928
Alignment:
| Q |
11 |
taaattactaaaaaacaataacaaagtaaattgtattaataaaggtgtcagaccaggttttgataaaagagaattcattgcaaattgcaatgtgaatacg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15402157 |
taaattactaaaaaacaataacaaagtaaattgtattaataaaggtgtcagaccaggttttgataaaagagaattcattgcaaattgcaatgtgaatacg |
15402058 |
T |
|
| Q |
111 |
attgagtctgcgtcagctgcatttgatcgtgattctcctcaatgtcaagaaccgtcacatgacttccaccaatttaaaaccttggtgctaagtgttcatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15402057 |
attgagtctgcgtcagctgcatttgatcgtgattctcctcaatgtcaagaaccgtcacatgacttccaccaatttaaaaccttggtgctaagtgttcatt |
15401958 |
T |
|
| Q |
211 |
attcataaaacttgcgtgttacattttctt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15401957 |
attcataaaacttgcgtgttacattttctt |
15401928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 15400169 - 15400123
Alignment:
| Q |
62 |
accaggttttgataaaagagaattcattgcaaattgcaatgtgaata |
108 |
Q |
| |
|
|||||||||| |||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
15400169 |
accaggttttaataagagatatttcattgcaaattgcaatgtgaata |
15400123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University