View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_248 (Length: 250)
Name: NF8208A_low_248
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_248 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 6e-49; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 83 - 185
Target Start/End: Complemental strand, 19198360 - 19198258
Alignment:
| Q |
83 |
tcaagtttattaaactttgtctgcatcatgtttaggttcttttagatctaaagatgaccaagctgtagaagaaaagaaaccggaaaaggccattacccct |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19198360 |
tcaagtttattaaactttgtctgcatcatgtttaggttcttttagatctaaagatgaccaagttgtagaagaaaagaaaccggaaaaggccattacccct |
19198261 |
T |
|
| Q |
183 |
gca |
185 |
Q |
| |
|
||| |
|
|
| T |
19198260 |
gca |
19198258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 83 - 142
Target Start/End: Complemental strand, 19202434 - 19202375
Alignment:
| Q |
83 |
tcaagtttattaaactttgtctgcatcatgtttaggttcttttagatctaaagatgacca |
142 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19202434 |
tcaagtttattaaacttagtctgcatcatgtttaggttcatttagatctaaagatgacca |
19202375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 148 - 205
Target Start/End: Complemental strand, 19202345 - 19202288
Alignment:
| Q |
148 |
tagaagaaaagaaaccggaaaaggccattacccctgcattatcaatgaaaaagacttc |
205 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
19202345 |
tagaagaaaagaaaccggaaaaagccattactcctgcaccatcaatgaaaaagacttc |
19202288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 14 - 57
Target Start/End: Complemental strand, 19198433 - 19198390
Alignment:
| Q |
14 |
aagatgagcacataccgctccatttatgaatcataattaccatt |
57 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19198433 |
aagatgagcacataccactccatttatgaatcataattaccatt |
19198390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University