View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_252 (Length: 250)
Name: NF8208A_low_252
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_252 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 235
Target Start/End: Original strand, 26624368 - 26624597
Alignment:
| Q |
7 |
tattcttcatctcaaggtcgacctaagggttaaaaagtccaaactaagactatagacctcaaaattttggttacaaaaggcttaacaaaagtttaatttt |
106 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
26624368 |
tattcttcatctcaaggtcgatctaagggttaaaaagtccaaactaaccctatagacctcaaaattttggttacaaaagacttaaaaaaagtttaatttt |
26624467 |
T |
|
| Q |
107 |
gttgataaacgtgaatgcatgagattcttttcataaagacttcatgatttttataa-ttgtaaaaggtttcacaatagaaaagttgcttttaaacctcta |
205 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26624468 |
gttgataaacgtgaatgcatgaaattcttttgataaagacttcatgatttttataatttgtaaaaggtttcacaatagaaaagttgcttttaaacctcta |
26624567 |
T |
|
| Q |
206 |
aacttattagaccagcccaacttcatctat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26624568 |
aacttattagaccagcccaacttcatctat |
26624597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University