View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_255 (Length: 249)
Name: NF8208A_low_255
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_255 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 37 - 249
Target Start/End: Complemental strand, 30499165 - 30498952
Alignment:
| Q |
37 |
acaaatgatccaatttttatctaactcttcacaaaatcat-acagtgcatctctcagagtgctcaagtatctcaagtcttgtcttggtaaaggtcttttc |
135 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||| | || ||| |||| |||||||||||||||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30499165 |
acaaatgagccaatttttatctaaccctacacaaacttattacaatgcacctctcagagtgctcaaatatctcaagacttgtcttggtaaaggttttttc |
30499066 |
T |
 |
| Q |
136 |
tttcccataaattgccccctttaccttcaagggttctctgatgctgattgggaagattgtcaagataccataaggtccatctcttgccagtgttgtttcc |
235 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||| | |||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30499065 |
tttcccataaattcccccctttaccttcaagagttctctgaagttgattgggcagattgtctggataccataaggtccatctcttgccagtgttgtttcc |
30498966 |
T |
 |
| Q |
236 |
ttggatattctcta |
249 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30498965 |
ttggatattctcta |
30498952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University