View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_262 (Length: 248)
Name: NF8208A_low_262
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_262 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 59 - 182
Target Start/End: Complemental strand, 45206259 - 45206136
Alignment:
| Q |
59 |
aactgtaagaaataatgcaggagttatggcatgccctttcaagttgtccaaagacaacattgaactgcagtttgccaccaatcacataggtatgtggtac |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45206259 |
aactgtaagaaataatgcaggagttatggcatgccctttcaagttgtccaaagacaacattgaactgcagtttgccaccaatcacataggtatgtggtgc |
45206160 |
T |
|
| Q |
159 |
atgttactgttttattctccggaa |
182 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45206159 |
atgttactgttttattctccggaa |
45206136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 65 - 155
Target Start/End: Complemental strand, 45247921 - 45247831
Alignment:
| Q |
65 |
aagaaataatgcaggagttatggcatgccctttcaagttgtccaaagacaacattgaactgcagtttgccaccaatcacataggtatgtgg |
155 |
Q |
| |
|
|||||| ||||||||| | ||| |||||||||||| | |||||||||||||||||||||| ||||||||||| || ||| ||||||||||| |
|
|
| T |
45247921 |
aagaaacaatgcaggaatcatgtcatgccctttcatgctgtccaaagacaacattgaactacagtttgccacaaaccacttaggtatgtgg |
45247831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 65 - 155
Target Start/End: Complemental strand, 45231725 - 45231635
Alignment:
| Q |
65 |
aagaaataatgcaggagttatggcatgccctttcaagttgtccaaagacaacattgaactgcagtttgccaccaatcacataggtatgtgg |
155 |
Q |
| |
|
|||||| ||||||||| | ||| ||||||||||| | ||||||||||||||||||||||||| ||||| || || ||| ||||||||||| |
|
|
| T |
45231725 |
aagaaacaatgcaggaatcatgttatgccctttcatgctgtccaaagacaacattgaactgcattttgctacaaaccacctaggtatgtgg |
45231635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 65 - 151
Target Start/End: Complemental strand, 45212929 - 45212843
Alignment:
| Q |
65 |
aagaaataatgcaggagttatggcatgccctttcaagttgtccaaagacaacattgaactgcagtttgccaccaatcacataggtat |
151 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||| | | ||||| |||||||| ||||| |||||||| || || ||| ||||||| |
|
|
| T |
45212929 |
aagaaacaatgcaggagtcatggcatgccctttcatgctttccaatgacaacatcgaactacagtttgcaacaaaccacttaggtat |
45212843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 45206313 - 45206282
Alignment:
| Q |
1 |
tacaatcattcaagtcaacacattagtactaa |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45206313 |
tacaatcattcaagtcaacacattagtactaa |
45206282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 19277760 - 19277712
Alignment:
| Q |
105 |
tccaaagacaacattgaactgcagtttgccaccaatcacataggtatgt |
153 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||| ||||||||| |
|
|
| T |
19277760 |
tccaaagacaacattgaactacaatttgccacaaatcatttaggtatgt |
19277712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University