View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_268 (Length: 247)
Name: NF8208A_low_268
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_268 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 23 - 247
Target Start/End: Complemental strand, 34974540 - 34974315
Alignment:
| Q |
23 |
actaattagttatgtattagatgtagttagtgtaccaaaacaaattatnnnnnnnn-tgactggcgcttgatgcttgtcggtgttagttttataggatag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34974540 |
actaattagttatgtattagatgtagttagtgtaccaaaacaaattataaaaaaaaatgactagtgcttgatgcttgtcggtgttagttttataggatag |
34974441 |
T |
|
| Q |
122 |
gatttgaactccgccatacagtgtcggattatgtaatattttgattaactaaggaattggatttttgaaataaattacctcttactctcgtcatatccaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34974440 |
gatttgaactccgccatacagtgtcggattatgtaatattttgattaactaaggaattggatttttgaaataaattacctcttactctcgtcatatccaa |
34974341 |
T |
|
| Q |
222 |
tcagctaatgtcaacaatttttattt |
247 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
34974340 |
tcagctaatgtcaaccatttttattt |
34974315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University