View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_273 (Length: 247)
Name: NF8208A_low_273
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_273 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 13886661 - 13886902
Alignment:
| Q |
1 |
atatagaatataaatgagttttagataagaatatattaatcatacgaatatacattttagtgagtcattcattcgctatgtttagtattattctcgatgg |
100 |
Q |
| |
|
||||| || |||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
13886661 |
atataaaagataaatgagttttagatacaaatattttaatcatacgaatatacattttaatgagtcattcattcgctatgtttagtatttttttcgatgg |
13886760 |
T |
|
| Q |
101 |
aagtagttgtgtctactttctagtcttgtaacnnnnnnnggcactcattggttatagagaggaaaaatgtagtggaatttgtataaatgagt--aaagtt |
198 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13886761 |
aagtagttatgtctactttctggtcttgtaaaaataaaaggcac-cattggttatagagaggaaaaatgtagtggaatttgtataaatgagtaaaaagtt |
13886859 |
T |
|
| Q |
199 |
tcattggtagtgttgtggattctcatcttctttgctagcttct |
241 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||| ||||| |
|
|
| T |
13886860 |
tcattggtgctgttctggattctcatcttctttgctaacttct |
13886902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University