View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_278 (Length: 246)
Name: NF8208A_low_278
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_278 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 8 - 231
Target Start/End: Original strand, 1841338 - 1841558
Alignment:
| Q |
8 |
acactgtgaactgcttctacctctcttcactctattttgttgatttatcttcatttcactctcttgattactttcatggctacgtttattattcttataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
1841338 |
acactgtgaactgcttctacctctcttcactccattttgttgatttattttcatttcactcttttgattactttcatggctacgtttat---tcttataa |
1841434 |
T |
|
| Q |
108 |
ttaggtgtagctggtatcatagttgaattatcaaaagacaaaatatatgtctttggagaagaacttctccgaggaacctttttcgatttcaaaccttgtt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1841435 |
ttaggtgtagctggtatcatagttgaattatcaaaagacaaaatatatgtctttggagaagaacttctccgaggaacctttttcgatttcaaaccatgtt |
1841534 |
T |
|
| Q |
208 |
cttgttcttgttcttgtggttgat |
231 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1841535 |
cttgttcttgttcttgtggttgat |
1841558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 111 - 231
Target Start/End: Original strand, 1824138 - 1824258
Alignment:
| Q |
111 |
ggtgtagctggtatcatagttgaattatcaaaagacaaaatatatgtctttggagaagaacttctccgaggaacctttttcgatttcaaaccttgttctt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |||| || |
|
|
| T |
1824138 |
ggtgtagctggtatcatagttgaattatcaaaagacaaaatatatgtctttggagaagaacttttacgaggaacctttttcgatttcaaaccatgttgtt |
1824237 |
T |
|
| Q |
211 |
gttcttgttcttgtggttgat |
231 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1824238 |
gttcttgttcttgtggttgat |
1824258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University