View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_279 (Length: 245)
Name: NF8208A_low_279
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_279 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 56 - 245
Target Start/End: Complemental strand, 29776475 - 29776286
Alignment:
| Q |
56 |
aatgttaatgcatataatatgtgaaggaaatgattcattgatttcttctcttgtttgcagattggcttggtgttgaagaagttgttggatgagggcgtag |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29776475 |
aatgttaatgcatataatatgtgaaggaaatgattcattgatttcttctcttgtttgcagattggcttggtgttgaagaagttgttcgatgagggcgtag |
29776376 |
T |
|
| Q |
156 |
tgaagcgcgaagatttgtggattacctctaaactctggtttgtatgaatgttttagctaatttatgaatgtgttagtcttgttcactgtt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776375 |
tgaagcgcgaagatttgtggattacctctaaactctggtttgtatgaatgttttagctaatttatgaatgtgttagtcttgttcactgtt |
29776286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 198
Target Start/End: Complemental strand, 29786751 - 29786681
Alignment:
| Q |
128 |
ttgaagaagttgttggatgagggcgtagtgaagcgcgaagatttgtggattacctctaaactctggtttgt |
198 |
Q |
| |
|
|||||||| ||||| | || ||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29786751 |
ttgaagaaattgtttgccgaaggcgtagtgaaacgtgaagatttgtggattacctctaaactctggtttgt |
29786681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University