View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_282 (Length: 245)
Name: NF8208A_low_282
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_282 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 30936502 - 30936644
Alignment:
| Q |
18 |
aaagaagcatataattttcatagcacataaatgctctttctttatatacaaatagaattacatgtgtaaactttattcttgaggccatgcgcaaataacg |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30936502 |
aaagaagcatataattttcatagcgcataaatgctctttctttatatacaaatagaattacatgtgtaaactttatccttgaggccatgcgcaaataacg |
30936601 |
T |
|
| Q |
118 |
aaacatgtaactatactcattctaacaaatcataatcttgatc |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30936602 |
aaacatgtaactatactcattctaacaaatcataatcttgatc |
30936644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University