View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_285 (Length: 244)
Name: NF8208A_low_285
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_285 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 22 - 231
Target Start/End: Original strand, 41701779 - 41701978
Alignment:
| Q |
22 |
acagtaaccgtaatcggagattgaaaagtagagttgctccccaatcttttccaatctccaattatggttgtagtcactgtttcttcaacattgtagattg |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41701779 |
acagtaaccgtaatcggagattgagaagtagagttgctccccaa----------tctccaattatggttgtagtcactgtctcttcaacattgtagattg |
41701868 |
T |
|
| Q |
122 |
tccgttcatcgattgtagagtagtctttgactctagtgacagttacagacggtacatctattgtgctatatagataaattagatttgttttctcttctaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41701869 |
tccgttcatcgattgtagagtagtctttgactctgatgacagctacagacgctacatctattgcgctatatagataaattagatttgttttctcttctaa |
41701968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University