View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_290 (Length: 244)
Name: NF8208A_low_290
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_290 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 19190395 - 19190619
Alignment:
| Q |
1 |
ggtggttatggttccgatgaccgttctggtggtggttatggcgctaatgaccgttatgagagtggatatgggcgttctgggggtggatatggggatggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
19190395 |
ggtggttatggttccgatgaccgttctggtggtggttatggcgctaatgaccgttatgagagtggatatgggcgttctggtggtggatatggtgatggag |
19190494 |
T |
|
| Q |
101 |
ggcgtacgagtattggtggatatggcgaagaaaaccgttctagtggtggctatgggtatggagggcgttctagtggttacggtaatgagcaaagttttgg |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190495 |
ggcgttcgagtattggtggatatggcgaagaaaaccgttctagtggtggctatggatatggagggcgttctagtggttacggtaatgagcaaagttttgg |
19190594 |
T |
|
| Q |
201 |
agggtatggtagggatggtcgtgat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
19190595 |
agggtatggtagggatggtcgtgat |
19190619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University