View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_300 (Length: 243)
Name: NF8208A_low_300
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_300 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 227
Target Start/End: Original strand, 56321334 - 56321547
Alignment:
| Q |
14 |
acatcagtgcttcaaatggttgctgcatttgaagaggcttctggcaaggtcnnnnnnnataatcttctgtactgtaacatgtatgcgtttccgaatgtat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56321334 |
acatcagtgcttcaaatggttgctgcatttgaagaggcttctggcaaggtctttttttataatcttctgtactgtaacatgtatgcgtttccgaatgtat |
56321433 |
T |
|
| Q |
114 |
tgtattgtgttcttaatccttcatttagctccttcttggatctgttttccagaaaattcctattaaaatgtgtccaaggaggcccggagatgctactgct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56321434 |
tgtattgtgttcttaatccttcatttagctccttcttggatctgttttccagaaaattcctattaaaatgtgtccaaggaggcccggagatgctactgct |
56321533 |
T |
|
| Q |
214 |
atctatgcttctac |
227 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
56321534 |
atctatgcatctac |
56321547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University