View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_304 (Length: 242)
Name: NF8208A_low_304
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_304 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 224
Target Start/End: Complemental strand, 45347482 - 45347276
Alignment:
| Q |
19 |
aggaagagtcaaattgagataggttgacaagcaaaggttttatttgtagtgttaaaactaacaaggaaaatgaatgagaggtaatggcttcacaattgca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45347482 |
aggaagagtcaaattgagataggttgacaagcaaaggttttatttgtagcgttaaaactaacaaggaaaatgaatgagaggtaatggcttcacaattgca |
45347383 |
T |
|
| Q |
119 |
tggtaccatcaacgtgttcgaccctcttttcatctctccgtcaatcacgctcttcactttctaattttgtgtcaaaacta-cttttttacccctttccct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45347382 |
tggtaccatcaacgtgttcgaccctcttttcatctctccgtcaatcacgctcttcactttctaattttgtgtcaaaactattttttttacccctttccct |
45347283 |
T |
|
| Q |
218 |
gtttcat |
224 |
Q |
| |
|
||||||| |
|
|
| T |
45347282 |
gtttcat |
45347276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University