View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_313 (Length: 240)
Name: NF8208A_low_313
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_313 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 21 - 222
Target Start/End: Original strand, 32766808 - 32767009
Alignment:
| Q |
21 |
agaagaataaggcagcacttaatattaaacctgataatctgagccagaacatatacagagaactcgatgccttgttgtttgaggcttatctgtaactatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32766808 |
agaagaataaggcagcacttaatattaaacctgataatctgagccagaacatatacagagaactcgatgccttgttgtttgaggcttatctgtaactatt |
32766907 |
T |
|
| Q |
121 |
gacaacttttggccaaccatttggtttgccaatgtactcttcccaacatttggtttaccaagtaaagccacgtatcctgcataacattttgacacacata |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32766908 |
gacaacttttggccaaccatttggtttgccaatgtactcttcccaacatttggtttaccaagtaaagccacgtatcctgcataacattttgacacacata |
32767007 |
T |
|
| Q |
221 |
at |
222 |
Q |
| |
|
|| |
|
|
| T |
32767008 |
at |
32767009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University