View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_320 (Length: 239)
Name: NF8208A_low_320
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_320 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 4 - 239
Target Start/End: Complemental strand, 56176894 - 56176659
Alignment:
| Q |
4 |
tcagacatgctaacatcgtcactgccaaggaatgatccactctcttcactggcaacacttctggtttcaggatcgtcttcaactaatcggaccttctgtt |
103 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56176894 |
tcagacatgctaacatcgtcaccgccaaggaatgatccactctcttcactggcaacacttctggtttcaggatcgtcttcaactaatcggaccttctgtt |
56176795 |
T |
|
| Q |
104 |
caatactcagagatctggccttccaaagagccatgatggtcctatattaacatattaacattttcagattcaacgaatataataatatccttaaaactat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56176794 |
caatactcagagatctggccttccaaagagccatgatggtcctatattaacatattaacactttcagattcaacgaatataataatatccttaaaactat |
56176695 |
T |
|
| Q |
204 |
taactattgagataatttcttaaaggtatcttagga |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
56176694 |
taactattgagataatttcttaaaggtatcttagga |
56176659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University