View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_327 (Length: 237)
Name: NF8208A_low_327
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_327 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 22 - 221
Target Start/End: Original strand, 2255453 - 2255653
Alignment:
| Q |
22 |
gtcgggtggtggtgggaatgtaacggcgcatcaacctgcaaagaacagacgcatgctatttgaccggggactgaaatggaatggaacagtaggtaccccc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2255453 |
gtcgggtggtggtgggaatgtaacggcgcatcaacctgcaaagaacagacgcatgctatttgaccggggactgaaatggaatggaacagtaggtaccccc |
2255552 |
T |
 |
| Q |
122 |
ttcctacactttcacctcacctg-ttagtttgtaggatggtccggtgggtaacacacagttcacctcgataactcaaaactatgcacgctctgtgctact |
220 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2255553 |
ttcctacactttcacctcacctgcttagtttgtaggatggtccggtgggtaacacacagttcacctcgataactcaaaactatgcacgctctatgctact |
2255652 |
T |
 |
| Q |
221 |
a |
221 |
Q |
| |
|
| |
|
|
| T |
2255653 |
a |
2255653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University