View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_33 (Length: 412)
Name: NF8208A_low_33
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_33 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 174 - 412
Target Start/End: Complemental strand, 6486616 - 6486378
Alignment:
| Q |
174 |
gttcgatgacccttagctcactagacgagctatttggattctttgcatgaacatggtgcagttcgctgcagaaccatttgatgtaaactgaatttgagtt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6486616 |
gttcgatgacccttagctcactagacgagctatttggattctttgcatgtacatggtgcagttcgctgcagaaccgtttgatgtaaactgaatttgagtt |
6486517 |
T |
|
| Q |
274 |
cacaaacggctctgcaatgtgctgcaccatacagagaatccaaatctaaataaaatgttattgtatcctaaaattaatcgttgctaacttataattaatt |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486516 |
cacaaacggctctgcaatgtgctgcaccatacagagaatccaaatctaaataaaatgttattgtatcctaaaattaatcgttgctaacttataattaatt |
6486417 |
T |
|
| Q |
374 |
tgaaatttggaattcagattaagtggtgagggctcacca |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486416 |
tgaaatttggaattcagattaagtggtgagggctcacca |
6486378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 6486769 - 6486678
Alignment:
| Q |
22 |
agaagcctatactgacgatgactatgccatgcgtagcagcagcgccgcctcccccatgagcccttactactacgaccctggaaggtctctcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486769 |
agaagcctatactgacgatgactatgccatgcgtagcagcagcgccgcctcccccatgagcccttactactacgaccctggaaggtctctcc |
6486678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University