View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_335 (Length: 235)
Name: NF8208A_low_335
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_335 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 39 - 235
Target Start/End: Original strand, 32891858 - 32892054
Alignment:
| Q |
39 |
ccaagaaaatccccccacccaacaatagacgtcgaaaagttccaaagagtgcgtttctcttggaacgctatggtccgcaagaattttctaacatgaccag |
138 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32891858 |
ccaacaaaatccccccacccaacaatagacgtcgaaaagttccaaagagtgcgtttctcttggaacgctatggtccgcaagaattttctaacatgaccag |
32891957 |
T |
|
| Q |
139 |
aaaacttgtctccccatcttccatattgttcatggtttgactccgagtagtaatctcaacatcagcaatttgatgttcttcattgtattccaagttc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32891958 |
aaaacttgtctccccatcttccatattgttcatggtttgactccgagtagtaatctcaacatcaacaatttgatgttcttcattgtattccaagttc |
32892054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University