View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_343 (Length: 234)
Name: NF8208A_low_343
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_343 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 23 - 221
Target Start/End: Original strand, 41969824 - 41970022
Alignment:
| Q |
23 |
acttcaatatgaaggtaactattaattgtccgaagacaggaaagaaagcctgggaacacttatacgaagtgatattgattcatgtctccaacaacactat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
41969824 |
acttcaatatgaaggtaactattaattgtccgaagacaggaaagaaagcctgggaacacttatacaaagtgatattgattcatgtctccaataacactat |
41969923 |
T |
|
| Q |
123 |
cacgacctaaaaatgcaatgggtgctcaaattttttgcttagaagaactctgcaattctatcatcaatgccttgagcctcccctgtttttcatatcagt |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41969924 |
cacgacctaaaaatgcaatggatgctcaaattttttgcttagaagaactctgcaattctatcatcaatgccttgagcctcccctgtttttcatatcagt |
41970022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University