View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_344 (Length: 234)
Name: NF8208A_low_344
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_344 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 37 - 234
Target Start/End: Original strand, 43239075 - 43239272
Alignment:
| Q |
37 |
catgtaaactattgtcttatacatgattcatacatttttctatgctgttttgttagtaattgttaacatcattaatgagtgtttcattcaatttgcagat |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43239075 |
catgtaaactattgtcttatacatgattcatacatttttctatgctgttttgttagtaattgttaacatcattaatgggtgtttcattcaatttgcagat |
43239174 |
T |
|
| Q |
137 |
tcatggcaacaagtggggttgatgttggtgacaggcttcaactgtggttggatattcagtttctctaacctgagaatggttccattaggttggacatg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43239175 |
tcatggcaacaagtggggttgatgttggtgacaggcttcaactgtggttggatattcagtttctctaacctgataatggttccattaggttggacatg |
43239272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University