View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_347 (Length: 234)
Name: NF8208A_low_347
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_347 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 12 - 224
Target Start/End: Original strand, 32759083 - 32759295
Alignment:
| Q |
12 |
agtaggtgttattgagactaactatgtgcatgtttgtattcataatggtttcaaattgtcaaagtaacactttgcttgaagaggttcgttttgttaagaa |
111 |
Q |
| |
|
||||| |||||||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32759083 |
agtagttgttattgagactaacaatttgcatgtttgtatgcataatggtttcaaattgtcaaagtaacactttgcttgaagaggttcgttttgttaagaa |
32759182 |
T |
 |
| Q |
112 |
taacgcaatcatacnnnnnnnnnnnntggcaattgatctgatttacttgttggttgatttaagagtgaagttgattatttgatgttgtgataacaaagct |
211 |
Q |
| |
|
||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32759183 |
taatgcaatcatacaaaaaataaaaatggcaattgatctgatttacttgttgattgatttaagagtgaagttgattatttgatgttgtgataacaaagct |
32759282 |
T |
 |
| Q |
212 |
tccctcttctatg |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32759283 |
accctcttctatg |
32759295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University