View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_355 (Length: 232)
Name: NF8208A_low_355
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_355 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 22 - 220
Target Start/End: Original strand, 21056585 - 21056783
Alignment:
| Q |
22 |
gaagatctcgaaggtgaatatgaatcatacaattttatacattatgcaacatgcacctgaattttatacagtatacatttcttgatatttaggcgttgtt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
21056585 |
gaagatctcgaaggtgaatatgaatcatacaattttatacattatgcaacatgcacctgaattttatacagtatacatttcttgatatttaagcattgtt |
21056684 |
T |
|
| Q |
122 |
taatttacattaaatcgcttgagaaaaatgcttctcttgcacctgtattttgatttactcgacatcatttcnnnnnnnattactaaaaggtgatgtcca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |||| |
|
|
| T |
21056685 |
taatttacattaaatcgcttgagaaaaatgcttctcttgcacctgtattttgatttactcgacatcgtttctttttttattactaaaaggtgatctcca |
21056783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 95 - 192
Target Start/End: Complemental strand, 26365350 - 26365252
Alignment:
| Q |
95 |
tacatttcttgatatttaggcgttgtttaatttacattaaatcgcttgagaaaaatgcttctcttg--cacctgtattttgatttactcgacatcatttc |
192 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| ||||| ||||| |||||||| |||||||| ||| |||||||||||||||||||| ||| ||||||| |
|
|
| T |
26365350 |
tacatttcttgatatttaggtgttgattaattcacattgaatcgtttgagaaacatgcttct-ttgcacacctgtattttgatttacttgacgtcatttc |
26365252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 26365405 - 26365357
Alignment:
| Q |
18 |
aaaagaagatctcgaaggtgaatatgaatcatacaattttatacattatgc |
68 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
26365405 |
aaaagaagatcttgaaggtgaat--gaatcatacaattttatacaatatgc |
26365357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University