View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_357 (Length: 231)
Name: NF8208A_low_357
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_357 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 79 - 185
Target Start/End: Complemental strand, 3600980 - 3600872
Alignment:
| Q |
79 |
ccaaaccatgaaataggtcaacgatgtcagctgattgaaaacttcaaaagtttaccc--nnnnnnnnngaacaagacaacggtcatttaaacgatgaaga |
176 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3600980 |
ccaaaccatgaaataggtcatcgatgttagctgattgaaaacttcaaaagtttacccaaaaaaaaagagaacaagacaacggtcatttaaacgatgaaga |
3600881 |
T |
 |
| Q |
177 |
tagatgtac |
185 |
Q |
| |
|
||||||||| |
|
|
| T |
3600880 |
tagatgtac |
3600872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University