View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_360 (Length: 231)
Name: NF8208A_low_360
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_360 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 211
Target Start/End: Complemental strand, 55427858 - 55427660
Alignment:
| Q |
13 |
tggacatcatatattcggtttttgaattggatgccggctgcacttagaatgccggaacctgagcttattgaccatgctggattggactctgttgtttact |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55427858 |
tggagatcatatattcggtttttgaattggatgccggctgcacttagaatgccggaacctgagcttattgaccatgctggattggactctgctgtttact |
55427759 |
T |
 |
| Q |
113 |
tgaggatttacttgttagggtatgatcatcaataattatggacagcgtttgaatataccatattggagaatatgatcactgatgttttgtttttgtttc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55427758 |
tgaggatttacttgttagggtatgatcatcaatcattatggacagcgtttgaatataccatattggagaatatgatcactgatgttttgtttttgtttc |
55427660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 125
Target Start/End: Original strand, 37418404 - 37418500
Alignment:
| Q |
29 |
ggtttttgaattggatgccggctgcacttagaatgccggaacctgagcttattgaccatgctggattggactctgttgtttacttgaggatttactt |
125 |
Q |
| |
|
|||| ||||| |||||||| |||||| | |||||||||||| || || ||||| ||||| || ||||| |||| ||| ||||||||||| ||||| |
|
|
| T |
37418404 |
ggttcttgaactggatgcctgctgcattgcaaatgccggaacccgaactaattgaacatgcaggcttggattctgctgtatacttgaggatctactt |
37418500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University