View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_364 (Length: 230)
Name: NF8208A_low_364
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_364 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 82 - 223
Target Start/End: Original strand, 25900156 - 25900297
Alignment:
| Q |
82 |
aagttcttgattcgagtttttgaactcaacaatgtaggatgacctttttggaataattttcaattcattttttaattgtcattatctaccaatgcaactg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25900156 |
aagttcttgattcgagtttttgaactcaacaatgtaggatgacctttttggaatacttttcaattcattttttaattgtaattatctaccaatgcaactg |
25900255 |
T |
|
| Q |
182 |
ttcctcccaagttaacatttcatcttatcacataactctaca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25900256 |
ttcctcccaagttaacatttcatcttatcacatacctctaca |
25900297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University