View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_370 (Length: 230)
Name: NF8208A_low_370
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_370 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 24 - 211
Target Start/End: Complemental strand, 40397057 - 40396870
Alignment:
| Q |
24 |
aacagagagaaaaattctaacgtgataattgcgattattcacttatacgtcgttgagaggagtttgaagatcatccacattagatt-atagtaacaacgc |
122 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
40397057 |
aacaaagagaaaaattctaacgtgataattgcgattattcacttatacgtcgttgagaggagtttgaagatcatccacattggattaatagtaacaacgc |
40396958 |
T |
|
| Q |
123 |
aattagttttgacactacatctttaccaannnnnnnaaagtattagattaaggatcatctcacttatgcgatgctttactttcatattt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
40396957 |
aattagttttgacactacatctttaccaattttttttaagtattagattaagaatcatctcacttatgtgatgc-ttactttcatattt |
40396870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University