View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_373 (Length: 230)
Name: NF8208A_low_373
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_373 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 6 - 218
Target Start/End: Complemental strand, 31636551 - 31636336
Alignment:
| Q |
6 |
actaaacctattctaactttctttcttcggctgcaagaatgaaacctcttcttcatccatcttcttttctctttttctccgtgatacttttaatgatctt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
31636551 |
actaaacctattctaactttctttcttcggctgcaagaatgaaacctcttcttcatccatcttcttttctctttttctccgtgatgcttttgatgatctt |
31636452 |
T |
|
| Q |
106 |
catcatcaatattccaacgtgtatgtgcgatgattacacagactgcaacgaagcttttgactgtgga---gacagtgtcacaaacctcaagtatccattc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || ||| ||| ||||||||||||||||||||||| |
|
|
| T |
31636451 |
catcatcaatattccaacgtgtatgtgcaatgattacacagactgcaacgaagcttttgaatgcggaagtagcagcatcacaaacctcaagtatccattc |
31636352 |
T |
|
| Q |
203 |
tggggaaaaaacagag |
218 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
31636351 |
tggggaaataacagag |
31636336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 93 - 218
Target Start/End: Complemental strand, 31621469 - 31621341
Alignment:
| Q |
93 |
ttttaatgatcttcatcatcaatattccaacgtgtatgtgcgatgattacacagactgcaacgaagcttttgactgtgga---gacagtgtcacaaacct |
189 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || ||| ||| |||||||||| |
|
|
| T |
31621469 |
ttttgatgatcttcatcatcaatattccaacgtgtatgtgcaatgattacacagactgcaacgaagcttttgaatgcggaagtagcagcatcacaaacct |
31621370 |
T |
|
| Q |
190 |
caagtatccattctggggaaaaaacagag |
218 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
31621369 |
caagtatccattctggggaaataacagag |
31621341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 139
Target Start/End: Complemental strand, 31616718 - 31616686
Alignment:
| Q |
107 |
atcatcaatattccaacgtgtatgtgcgatgat |
139 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
31616718 |
atcatcaatattccaacgtgtatgtgtgatgat |
31616686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University