View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8208A_low_376 (Length: 230)

Name: NF8208A_low_376
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8208A_low_376
NF8208A_low_376
[»] chr6 (1 HSPs)
chr6 (1-108)||(15112857-15112964)


Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 15112964 - 15112857
Alignment:
1 tatagtaaaccttagcttgagtcgttgtaatcgtactgaaatgctattgtttatcttattactaatagttattattagatgaacgaagtaactacactat 100  Q
    |||||||||  |||||||||||| |||||||| |||||||||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||    
15112964 tatagtaaaagttagcttgagtcattgtaatcatactgaaatgctatcgtttatcttattactactatttattattagatgaacgaagtaactacactat 15112865  T
101 tctcatat 108  Q
    ||||||||    
15112864 tctcatat 15112857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University