View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_378 (Length: 230)
Name: NF8208A_low_378
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_378 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 4049580 - 4049357
Alignment:
| Q |
1 |
tttagaaagtcaagcaaatgtgagatcaccagccattgcgataaagcaagaaaaggtatgaacaacatctgttttcattttatattggattctcaatctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4049580 |
tttagaaagtcaagcaaatgtgagatcaccagccattgtgataaagcaagaaaaggtatgaacaacatctgttttcattttatattggattctcaatctg |
4049481 |
T |
|
| Q |
101 |
atattcaatcttgttttcagtttcctattgagattgtgttatctaaatcgacatttcaatggaacttgcagatttcaaagcctgtttatacaagcacaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4049480 |
atattcaatcttgttttcagtttcctattgagattgtgttatctaaatcgacatttcaatggaacttgcagatttcaaagcctgtttatacaaccacaaa |
4049381 |
T |
|
| Q |
201 |
agttgagcacttaagagaatgttt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4049380 |
agttgagcacttaagagaatgttt |
4049357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University