View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_38 (Length: 404)
Name: NF8208A_low_38
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 4e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 7 - 201
Target Start/End: Complemental strand, 44407419 - 44407221
Alignment:
| Q |
7 |
attagttagcaataaatactaacatcaatgaattaagt----tgattgaaatcaaaacaccattacattgcatatagggttgggaattaagaacttacca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44407419 |
attagttagcaataaatactaacatcaatgaattaattaaggtgattgaaatcaaaacaccattacattgcatatagtgttgggaattaagaacttacca |
44407320 |
T |
 |
| Q |
103 |
tctgtataagacaaagcaccttggcataccgagaggaatagaaccaatagaactttaaacttctgcatattttaattttttgtttgtatgaatctcaaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407319 |
tctgtataagacaaagcaccttggcatactgagaggaatagaaccaatagaactttaaacttctgcatattttaattttttgtttgtatgaatctcaaa |
44407221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 257 - 393
Target Start/End: Complemental strand, 44407160 - 44407024
Alignment:
| Q |
257 |
cacagggttttatttgaatcataaaatgaaaatgccactaaattcagcaaaaaataacatcaatgccactggaactatcctatcctaaattttccagcaa |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407160 |
cacagggttttatttgaatcataaaatgaaaatgccactaaattcagcaaaaaataacatcaatgccactggaactatcctatcctaaattttccagcaa |
44407061 |
T |
 |
| Q |
357 |
gagatggctttgccctgaatacatacatgttagtatt |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407060 |
gagatggctttgccctgaatacatacatgttagtatt |
44407024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University