View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_381 (Length: 230)
Name: NF8208A_low_381
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_381 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 26 - 221
Target Start/End: Complemental strand, 36526149 - 36525954
Alignment:
| Q |
26 |
taacgtcgcaatgcatatgccactttggggggctatctgttttatgttatccagtatttttatattgctctctctatacggtagtaatatagatagtaac |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36526149 |
taacgtcgcaatgcatatgccactttggggggctatctgttttatgttttccagtatttttatattgctctctctatacgatagtaatatagatagtaac |
36526050 |
T |
|
| Q |
126 |
aatagcatcgtggggaaaacgaagaataaaccatcgatgtagtccgtaaactatcacttacgctccaatttgaagtctaaattatgtaagtataat |
221 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||| |||||||||||| ||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
36526049 |
aatagcattgcagggaaaacgaagaataaaccatcgatgtagtctgtaaactatcacctacacttcaatttgaagtctaaattatgtaaatataat |
36525954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University