View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_383 (Length: 230)
Name: NF8208A_low_383
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_383 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 2794291 - 2794519
Alignment:
| Q |
1 |
aagaattgaatgtgcatgatattgatgcgtattggcttcagaggaaaatctcgccggcttttggaccagagattgatccagaaaatcgtcgaaggcttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
2794291 |
aagaattgaatgtgcatgatattgatgcgtattggcttcagaggaaaatctcgccggcttttggaccagagattgatccggaaaattgtcgaaggcttgc |
2794390 |
T |
 |
| Q |
101 |
tgaagaggtgttgaaggttttgggtgaggctgatgaccgagaagtggagaagaggttgctggggtattttgatttgaataagtttagtcttgttaagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2794391 |
tgaagaggtgttgaaggttttgggtgaggctgatgacagagaagtggagaagaggttgttggggtattttgatttgaataagtttagtcttgttaagttt |
2794490 |
T |
 |
| Q |
201 |
ctgatgcagaataagttgaagattgtgtg |
229 |
Q |
| |
|
|| |||||||||||||||||||||||||| |
|
|
| T |
2794491 |
ctaatgcagaataagttgaagattgtgtg |
2794519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University