View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_393 (Length: 229)
Name: NF8208A_low_393
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_393 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 229
Target Start/End: Complemental strand, 6990455 - 6990245
Alignment:
| Q |
19 |
ctttatctaatgagtagcaatacgaaataaaataaaactatgactcttttttggtcgtttacttttcttctaacacgtgaaaatctctctttctcatgcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6990455 |
ctttatctaatgagtagcaatacgaaataaaataaaactatgactcttttttggtcgtttacttttcttctaacacgtgaaaatctctctttctcatgcc |
6990356 |
T |
 |
| Q |
119 |
ttgttcgtatatataaatgcatggttacttttaaataattgaacgcattcacaatgattctaattttattttttataatgatatgatgagctgtagtaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6990355 |
ttgttcgtatatataaatgcatggttacttttaaataattgaacgcattcacaatgattctaattttattttttataatgatatgatgagctgtagtaac |
6990256 |
T |
 |
| Q |
219 |
tattttatcaa |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
6990255 |
tattttatcaa |
6990245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University