View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_398 (Length: 229)
Name: NF8208A_low_398
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_398 |
 | |
|
| [»] scaffold0020 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 24617189 - 24616963
Alignment:
| Q |
1 |
ggaaaacctagctacgggaagaaatcacacattatttgcgaaaatagctgaacaaggatagattttgtaagccacaatatcttggccaatatgactagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24617189 |
ggaaaacctagctacgggaagaaatcacacattatttgcgaaaatagctgaacaaggatggattttgtaagccacaatatcttggccaatatgactagtt |
24617090 |
T |
|
| Q |
101 |
ttatctataaataccacacttgttcactttattaaatagactcgatcaataaaccaagtgatttttatgtcgttcaaaggaagttcggttggtgcacttg |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
24617089 |
ttatctataaataccacacttgtacactttattaaatagactcgatcaataaaccaagtgatttttatgtcgttcaaaggaagttcagttggtgtacttg |
24616990 |
T |
|
| Q |
201 |
gaat----atatgaaatggattgttat |
223 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
24616989 |
gaatatatatatgaaatggattgttat |
24616963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 40 - 123
Target Start/End: Complemental strand, 167231 - 167147
Alignment:
| Q |
40 |
gaaaatagctgaacaaggatagattttgtaagccacaatatcttggccaatatgactagttttatc-tataaataccacacttgt |
123 |
Q |
| |
|
||||||||| |||||||| |||||| || ||||| |||| ||||||||||||||||||||| || |||||| | ||||||||| |
|
|
| T |
167231 |
gaaaatagccgaacaaggttagattggataggccacgatattttggccaatatgactagttttttcttataaacatcacacttgt |
167147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University