View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_406 (Length: 227)
Name: NF8208A_low_406
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_406 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 11565686 - 11565490
Alignment:
| Q |
19 |
gacatgaacgacggaaatggcgcagattgtggtgagttatggggaacagaggattaactgcgttgtggtagttcgggttcgtcgaagaagttgtgtttca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11565686 |
gacatgaacgacggaaatggcgcagattgtggtgagtaatggggaacagaggattaactgcgttgtggtagttcgggttcgtcgaagaagttgtgtttca |
11565587 |
T |
|
| Q |
119 |
cgtgaatggatagataataggtattgataactgattgagtaaagaagaaacaagtgtttaattccaacaatttgtagtgcacttgcatattattcga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
11565586 |
cgtgaatggatagataataggtattgataactgattgagtaaagaagaaacaagtgtttaattccaacaatttgtagtgcacttgcatttcattcga |
11565490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University