View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_412 (Length: 225)
Name: NF8208A_low_412
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_412 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 82 - 203
Target Start/End: Original strand, 11107902 - 11108023
Alignment:
| Q |
82 |
ttaaccctatattcttttaccaatattatgggtttgaactatccattgacttttgtcgacgattaacttgatcgaaaaatcgagctagctgcatttaatg |
181 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11107902 |
ttaaccctatattcttttaccaatgttatgggtttgaactatccattgaaatttgtcgacgattaacttgatcgaaaaatcgagctagcttcatttaatg |
11108001 |
T |
|
| Q |
182 |
gagtctccttagtccttaccat |
203 |
Q |
| |
|
||||||||||| ||||| |||| |
|
|
| T |
11108002 |
gagtctccttaatcctttccat |
11108023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 11107171 - 11107236
Alignment:
| Q |
20 |
atgaatattattgtattaaactgatggacaatactctacgtccaacctaccttacttttgggttaa |
85 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
11107171 |
atgaatattattgttttaaactgatggacaatactctacatccaacctaccttatttttgggttaa |
11107236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University