View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_417 (Length: 224)
Name: NF8208A_low_417
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_417 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 19 - 137
Target Start/End: Complemental strand, 44575533 - 44575415
Alignment:
| Q |
19 |
atcacatgactctatcctcatcgtatgaccacatgcaatccaaattcccgcagtaacatgtagatgaaatcacgtttgatgggttaggtaacgtggaaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44575533 |
atcacatgactctatcctcatcgtatgaccacatgcaattcaaattcccgcagtaacatgtagatgaaaccacgtttgatgggttaggtaacgtggaaat |
44575434 |
T |
|
| Q |
119 |
aagaggttatcttgttgga |
137 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44575433 |
aagaggttatcttgttgga |
44575415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 201
Target Start/End: Complemental strand, 44575402 - 44575358
Alignment:
| Q |
156 |
gaaagattttatgactaattgttgaaaaaatatgttagcaacacga |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44575402 |
gaaagattt-atgactaattgttgaaaaaatatgttagcatcacga |
44575358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University