View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_425 (Length: 221)
Name: NF8208A_low_425
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_425 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 63 - 215
Target Start/End: Complemental strand, 9985416 - 9985264
Alignment:
| Q |
63 |
ctctcctatagaatatgttatgttaatcccttcaagtataatgtttgtgcaagttatggcttcatcacaatgtaattgaattacatctttagcaatagat |
162 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
9985416 |
ctctcctatagaagatgttatgttaatcccttcaagtataatgtttgtgcaagttatgtcttcatcacaatgtaattgaattgcatgtttagcaatagat |
9985317 |
T |
 |
| Q |
163 |
gttcctcttatgttgcggaaagttacatcacttactttcactgcatatacact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9985316 |
gttcctcttatgttgcggaaagttacatcacttactttcactgcatatgcact |
9985264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University