View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_441 (Length: 215)
Name: NF8208A_low_441
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_441 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 31 - 195
Target Start/End: Complemental strand, 46996996 - 46996827
Alignment:
| Q |
31 |
agcaaatctcaaagcttagagagcgataatttataaaacactcacatgagagagatcattatc--gccattnnnnnnnnnga-----tcattaacttgac |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| || |||||| |||||| |
|
|
| T |
46996996 |
agcaaatctcaaagcttagagagcgataatttataaaacactcacatgagaga--tcattatctggccattcaaaaaaaagaaaagatcattatcttgac |
46996899 |
T |
 |
| Q |
124 |
cgtagaggttgaactcacaacgttataagtgagtcaaaataaaacgaaatcgagtaagtataattcttatat |
195 |
Q |
| |
|
|| |||||||||||||||||| |||||||||||||||||| ||||||||| || |||||||||||||||||| |
|
|
| T |
46996898 |
cgcagaggttgaactcacaaccttataagtgagtcaaaatgaaacgaaatagaataagtataattcttatat |
46996827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University